An immunogenetics study of HLA-DQ2 gene for celiac disease among sample of Iraqi patients in Babylon Province

Zainab Dheyaa Falih, Zahraa Watheq Mahdi, Haider Turky AL_Mousawi2 1 Department of Molecular genetic, Wahj Al-DNA Company, Baghdad, Iraq 2 Department, Biotechnology college, AL-Qassim Green University, Iraq *Corresponding Author Email: zaynab.m111320@biotech.uoqasim.edu.iq

Abstract

This study included celiac disease ; an autoimmune genetic disease that occurs due to the ingestion of gluten; a protein found in wheat and barley and stimulates an immune response in the small intestine where this response damages the lining of the small intestine over time and prevents it from absorbing certain nutrients (malabsorption) intestinal damage often leads to diarrhea, fatigue, weight loss, bloating, anemia, and can also lead to serious complications.The most important causative gene of the disease is the HLA-DQ2 and HLA-DQ8 gene, as well as environmental factors ( gluten ingestion ).The current study was conducted from ( November 202 2 to May 202 3) on 20 patients and 10 healthy people who do not suffer from the disease, hereditary blood diseases and who were in the same age group as the patients.Blood and serum samples were collected from ( Babylon Teaching Hospital) and the study was conducted using conventional PCR, which showed that the size of the HLA-DQ2 gene is approximately 153 bp, and it was found that the homologous HLA-DQ2 gene constitutes the most common genotype in celiac disease  patients, where their percentage ( 77.2%) was in 14 patients while the rest of the patients did not show the gene because they have followed strict gluten-free diet while the control was their percentage 0%.As for the immunological test, the percentage of IgA and IgG appeared high in 14 patients (71.2%) because they had the disease, while the remaining percentage (28.8%) the IgA and IgG was normal  for  them because they did not have the disease

Keywords: Celiac disease, HLA-DQ2,immunological test

Introduction

Celiac disease is an immune inflammatory illness in small intestine occurred by the consumption of gluten protein in people who have a genetic susceptibility to humans leukocyte antigens (HLA-DQ2) or )HLA-DQ8(. Consumption of this protein encourages immune in small intestinal mucosa inflammation, which results in villous atrophy and crypt hyperplasia, which results in malabsorption and gastrointestinal symptoms)Tamai and Ihara,2023). Celiac disease appears after an individual or child first consumes gluten. It most commonly appears during two distinct age windows, according to healthcare providers: early childhood, between the ages of 8 and 12 months, and mid-life, between the ages of 40 and 60. Early childhood is typically when children begin eating solid foods, which may include gluten-containing biscuits /or cereals (Carreras, 2022).

Genetic predisposition to celiac disease includes the human leukocyte antigen (HLA-DQ2 and HLA-DQ8) as major risk factors: accounting for approximately 40% of the disease heritability. The remaining 60% of celiac disease susceptibility is shared by an unknown number of non-HLA genes, each of which is believed to contribute just a minor risk. The first genome- wide association study on celiac disease, as well as its follow-up, recently discovered 9 non-HLA loci that contribute to celiac disease risk (Romanos,2011 ). The HLA complex is mainly related to CD, and it consists of 47Mb on chromosome 6p21. It contains approximately 200 genes, of which more than half have an immune purpose.

The HLA genes are known to have a minor impact on celiac disease heritability and to exhibit Mendelian inheritance with imperfect penetrance (Salazar  et al.,2017). The restriction of HLA strong  in celiac illness is associated with the gluten characteristic. Gluten peptides are presented to T cells via HLA- DQ2/DQ8 molecules, which activate gluten-specific CD4+ T cell ) Slydahl ,2020).

 Celiac disease pathogenesis is determined by genetic factors as well as mucosa immune response. This immunity disorder develops in genetically susceptible patient after being triggered by environmental agent, gluten in the diet. In response to gliadin fractions, an inflammatory response occurs, resulting in inflammation of the lamina propria and epithelium; disruption of epithelial layers, and villous atrophys (Carreras, 2022). The disease is occurred by abnormal immune response to gluten proteins in the diet. This immune response is mediated by lamina propria CD4 T cells recognize gluten peptide in the context of disease-susceptible  )HLADQ2) and )HLADQ8) molecules (Carreras, 2022; Tamai and Ihara,2023).T cells recognize proline and glutamine rich gluten peptide that resists proteolysis by transglutaminase (Carreras, 2022). Surprisingly, when exposed to dietary gluten, celiac disease patient produce the antibodies to this enzyme (Sollid and Lundin, 2009).This study aims to determine the presence of immunoglobulin IgG and IgA in both patients and the presence of HLA-DQ8 gene.

Methods

Ethical approval

This study obtained oral consent from 20 patients diagnosed with celiac disease and 15 healthy subjects, whose ages ranged between (10-65) from (November 2022-May 2023) .Also,ten healthy people without celiac from the population of Babylon were randomly assigned to a group of (10) female and male patients between the ages of (20-30) years.

Blood collection

Three ml of blood are collected via vein puncture in EDTA tubes and Two millilitres of blood in gel tubes from all patients and control groups and are stored in the refrigerator (4ºC) to  DNA extraction, molecular analysis, and hepatitis analysis.

Anti-Gliadin IgA and IgG antibodies

This test was carried out to detect the Anti-Gliadin antibodies type IgA and IgG by ELISA.

Isolation of DNA

Genomic DNA of Frozen whole blood collected  in  EDTA  was isolated according to Promega purification kit. DNA solutions’ Purity and concentration were measured using spectrophotometry with Nano drop. The DNA had approximate concentration of 200-250 ng/μl with high purity sample .

Identification of conventional Polymerase chain reaction (PCR) Technique for Celiac.

The diagnosis of polymerase chain reaction (PCR) for celiac is usually based on the use of genomic DNA. Preparation of genomic DNA can result in sample-to-sample contamination and contaminated samples must be discarded. Gene in Iraq is widespread.Primer sets were selected for conventional PCR analysis of mutations showed in table (1), We designed each primer by NCBI BLAST, defined its conditions by optimise protocol writer, and tested each primer in SMS (Sequence manipulation suite) , primer 3 input, and other bioinformatics programs.

Table1: Sequences of the primers to detect HLA-DQ2 gene

 

Name of

Primer

Sequence of Primer (5′-3′) Primer Size
HLA-DQ2 Forward : TCCTGCATTGGAAAATGTGA

Reverse  : CGAAGACTCCCTCTCTGTGG

 

153 bp

Conventional PCR Components

The protocols of PCR reaction mixture volumes are as follows in table (2 ).

Table 2:Conventional PCR components

Mixture solution Volume
Master mix 12 μl
Forward primer 1 μl
Reverse primer 1 μl
Target DNA 5 μl
Nuclease free water 6 μl
Total volume 25 μl

 

 Conventional -PCR Protocol

All samples are tested according phenotype of disease for both patient and the control groups. PCR a program: To identification to present or absent (HLA-DQ2) in sample by use conventional -PCR program was mentioned in table 3) ).

Table 3: Conventional -PCR a program (HLA-DQ2gene)

Step Temperature(°C) Time No. Cycles
Initial denaturation 94°C 5min
Denaturation 94°C 45sec  

30 cycle

Annealing 57°C 1min
Extension 72°C 45sec
Final extension 72°C

 

Analysis of conventional -PCR Product

Use 10 μl of PCR product from master mix carefully added to individual wells. The electrophoresis proceeded for about 1:30 hour at 70 volt. The size of DNA fragment of gene was determined by running 1000 bp DNA ladder with DNA samples. DNA bands were visualized by U.V at illumination 350nm wave- length on U.V transilluminator system.

 

Results and Discussion

Distribution of the samples according to the age categories

The study was conducted during the period from (1/11/2022 to 11/5/2023) and (20) patients were taken a male and a female were randomly assigned to Celiac major patients from Babylon Hospital, with(10) control and their ages ranged between (20-65) years as shown in table (4-1).The descriptive analysis of samples appeared that the patient was aged between 10 and 65. Considering the age distribution as showed in table (4), of patients were 10-20 years old, 14 were 20-39 years old, 3were 31-65 years old.

Table 4: Distribution of the samples according to the age categories

Age (years) No. %
10- 20 3 14.4
21- 30 14 71.2
31-65 3 14.4
Total 20 100%

 

Immunological tests (anti- gliadin antibodies)

The result of this study obtained from the serological test were (71.2%) 14 patients were positive for IgG, while the (71.2%) 14 of patients were positive for IgA. While the results obtained from the control were (10%) subjects  for  both IgA and IgG  all of them were negative that show in table (5) showed distribution of IgG and IgA in patients and control group according to serological test.

Table5: Immunological tests

Immunoglobulin Groups No.% mg/dl
 

IgG

Patients group    
Positive 14 (71.2%) 19.55
Negative 6 (28.8%) 11.12
Total 20( 100%)  
IgA Positive 14(71.2%) 27.45
Negative 6(28.8%) 11.28
Total 20(100%)  
IgG Healthy group    
Positive  
Negative  
Total 10(100%) 12.25
IgA Positive  
Negative  
Total 10(100%) 12.11

 

     

The majority of studies focused on understanding the CD pathophysiology is checking of biological characteristics of the patients with  CD . Existence of high titers of “Anti-α-gliadin antibodies” (IgA and IgG) was indicated to be positive indicators of the CD but it demands additional investigations In “Anti-α-gliadin antibodies” test, the specificity and sensitivity of IgA were superior to the IgG, yet IgG test is useful with1% to 2% of CD patients who have a deficiency of IgA . Other studies also assured  that Immunoglobulin G (IgG)-“Anti-α-gliadin antibodies” is more sensitive yet less specificity, and IgA-“Anti-α-gliadin antibodies” was low sensitive yet more specificity. It was best to apply these tests to give outcomes of a higher detection rates ( Al-Thwani and Al-Segar,2017 ).

In this study,   classes IgG and IgA seropositivity of anti-gliadin were noted in 14 patient ( 71.2% in all patients).

Based on gender, 16 female patients (55.6% in females) tested a positive for “anti-gliadin of IgA , and anti-gliadin of IgG ” respectively, whereas  4 patients of males (44.4% of male ) examined the positive for “anti-gliadin of IgA and anti- gliadin of IgG ” respectively. The outcomes obtained indicated a CD female predominance,” anti-gliadin” has been related to low specific with its useful limited to the diagnosis of individuals with wheat sensitive, gluten metabolisms abnormalities, and diagnosis  early of  children with CD. Also, the IgA antibodies class has been seen to own the superior specific and sensitive to celiac illness contrast to the IgG class which has been related to a high rate of false positives and  useful in conditions of IgA deficient patients (Algraittee et al.,2021).

Molecular identification of of HLA-DQ2gene of celiac patient

The results of the detection of the HLA-DQ2 genes selected in the current study when examined using conventional PCR showed that the presence of the HLA-DQ2 gene in the CD patients that causes celiac disease in 75% of all patients, while the control group was 0% in this gene and the size of the HLA-DQ2 gene is bp 153 when compared with 1000 pb DNA Ladder in gel electrophoresis after using with special primer. After gel electrophoresis with 1.5% agarose, Volts 75 for an 45 minute, and then photographing it on its UV lights along a wave of 254 nm it showed the result gel electrophoresis in the following figure (1).

 

Figure 1: Electrophoresis of PCR products of HLA-DQ2 gene with 1.5% agarose, Volts 75for an 45 minutes, L (1000pb ) DNA Ladder),

The results of the detection of the HLA-DQ2 genes selected in the current study when examined using conventional PCR showed that HLA- DQ2 gene did not appear in all CD patients and its percentage was75%, while negative results are because the patient we obtained were ill for a certain period of their lives and after following a gluten-free diet and taking medications, this caused a decrease in gene expression(Zubkiewicz-Kucharska et al.,2022 ).

HLA-DQ8 and HLA-D2 are the alleles for MHC II ( major histocompatibility complex ), making genetic susceptible to CD. Research showed  homozygosity of HLA-DQ2 is a genotype that is the highest risk as it award  (25 –  30%) risk to developing early patients with CD.HLA-DQ2/DQ8 heterozygote were shown to have the low risk of evolution CD  having a distribution rate( 25 – 35%) in  population, the eventuality of developing CD patients at 3% with this genotype. So, HLA-DQ2 homozygote form the predominant in CD patients.

This is in agreed  with the results of current study with the majority  patients 77.2% was HLA-DQ2 homozygote. Another study performed  on 74 with CD  reported a prevalence at ( 79.7%) for HLA-DQ2 and HLA-DQ8  (8.1% )while HLA-DQ2/DQ8 was a prevalence of (10.8%).  it was indicated   HLA-DQ2 confer antigenic recognitions epitope for gliadin antigen and a high ability for binding to high rate of gluten peptide, on MHC II of APC in the people with those genotypes and a high risk of   gluten-related to enteropathy)Tamai and Ihara,2023).

Conclusions

It was found that the homologous HLA-DQ2 gene constitutes the most common genotype in celiac disease  patients( 77.2%) was in 14 patients while the rest of the patients did not show the gene because they have followed strict gluten-free diet while the control was their percentage 0%.As for the immunological test, the percentage of IgA and IgG appeared high in 14 patients (71.2%), while the remaining percentage (28.8%) the IgA and IgG was normal for them .

Acknowledgment

None .

 

Conflicts of Interest

None.

References

  • Algraittee, S. J. R. (2021).  Evaluation of HLA-DQ2 and DQ8 haplotypes in patients with Celiac Disease Correlation with Circulating Anti-Tissue Transglutaminase and Anti-Gliadin Antibodies .Doctoral dissertation, Department of Medical Microbiology A thesis Submitted to the Council of the College of Medicine, University of Kerbala).
  • AL-Thwani, A. N., & AL-Segar, R. Q. (2017). Serological Study for Celiac Disease among Sample of Iraqi Patients. Journal of Biotechnology Research Center, 11(2), 25-29.
  • Carreras, J. (2022, August). Artificial intelligence analysis of celiac disease using an autoimmune discovery transcriptomic panel highlighted pathogenic genes including BTLA. In Healthcare (Vol. 10, No. 8, p. 1550). MDPI.
  • Koehler, P., Wieser, H., & Konitzer, K. (Eds.). (2014). Celiac disease and gluten: multidisciplinary challenges and opportunities.
  • Maglio, M., & Troncone, R. (2020). Intestinal anti-tissue transglutaminase2 autoantibodies: pathogenic and clinical implications for celiac disease. Frontiers in Nutrition, 7, 73.
  • Megiorni, F., & Pizzuti, A. (2012). HLA-DQA1 and HLA- DQB1 in Celiac disease predisposition: practical implications of the HLA molecular typing. Journal of biomedical science, 19, 1-5.
  • Olén, O. (2008). Complications and associated conditions of celiac disease. Karolinska Institutet (Sweden).Celiac Disease: Symptoms & How It’s Treated. (2022) .Cleveland Clinic
  • Romanos, J. (2011). Genetics of celiac disease and its diagnostic value. University Library Groningen][Host].
  • Salazar, C., García-Cárdenas, J. M., & Paz-y-Miño, C. (2017). Understanding celiac disease from genetics to the future diagnostic strategies. Clinical Medicine Insights: Gastroenterology, 10, 1179552217712249.
  • Sallese, M., Lopetuso, L. R., Efthymakis, K., & Neri, M. (2020). Beyond the HLA genes in gluten-related disorders. Frontiers in Nutrition, 7, 575844.
  • Siddiqui, K., Uqaili, A. A., Rafiq, M., & Bhutto, M. A. (2021). Human leukocyte antigen (HLA)-DQ2 and-DQ8 haplotypes in celiac, celiac with type 1 diabetic, and celiac suspected pediatric cases. Medicine, 100(11).
  • Slydahl, M. M. (2020). Nutrient content in gluten free and gluten containing products(Master’s thesis, OsloMet-storbyuniversitetet. Institutt for sykepleie og helsefremmende arbeid).
  • Sollid, L. M., & Lundin, K. E. A. (2009). Diagnosis and treatment of celiac disease. Mucosal Immunology, 2(1), 3-7.
  • Tamai, T., & Ihara, K. (2023). Celiac Disease Genetics, Pathogenesis, and Standard Therapy for Japanese Patients. International Journal of Molecular Sciences, 24(3), 2075.
  • Zubkiewicz-Kucharska, A., Jamer, T., Chrzanowska, J., Akutko, K., Pytrus, T., Stawarski, A., & Noczyńska, A. (2022). Prevalence of haplotype DQ2/DQ8 and celiac disease in children with type 1 diabetes. Diabetology & metabolic syndrome14(1), 128.

 

 

You might also enjoy

More articles