Unveiling of virulence factors in Staphylococcus aureus in patients with diabetics

Hayder Shukur Ghulam*1, Seçil Akıllı Şımşek 1 1Department Biology , College Science, Çankırı Karatekin University,Turkey *Corresponding Author email: haydershukur1982@gmail.com

 Abstract

One of the most common public health issues in the world, diabetic foot infection (DFi), affects a large number of people. Diabetes patients may have a lower quality of life if they develop chronic ulcers that eventually result in amputation. This study aims to the detection of virulence Staphylococcus aureus by mecA gene in patients with diabetes.A total of 300 specimens were taken from diabetic foot ulcer patients, ages 30 to 89, who were admitted to Al-kindy Teaching Hospital ( December 2021 -March 2022) .Out of 300 isolates, the analysis revealed that 171 were Gram positive,  and after several testing, 150 isolates were found to have positive Staphylococcus aureus results. Vitek 2 was used to make the diagnostic to ensure accuracy. The outcomes of an antibiotic sensitivity test conducted using the vitek2AST technology revealed total sensitivity to ciprofloxacin, levofloxacin, and tigecycline, as well as 100% resistance to each of the antibiotics oxacillin and benzoyl penicillin.

Using a PCR technique with a size of 162 pairs for the mecA gene is the diagnostic gene for staphylococcus the results revealed that the prevalence rate among the isolates was 90%. The first isolate from Iraq was registered in the NCBI  for mecA gene ID ON551387.The first isolate from Iraq was registered in the NCBI, mecA gene ID ON551387.

Keywords: Staphylococcus aureus,mecA gene ,Diabetes

Introduction
Staphylococcus aureus is a bacteria that lives in the skin and mucous membranes. It can cause a variety of illnesses in hospitals and the population and is highly pathogenic (Altaee et al., 2020). Staphylococcus aureus has long been the most common hospitalized infection and the main cause of hospital-associated mortality. However, there was a rise in Staphylococcus aureus infections in the community. Skin infections, infective endocarditis, pleuropulmonary infections, osteoarticular infections, and bacteremia are examples of significant clinical illnesses caused by Staphylococcus aureus. Meningitis, epidural abscess, otitis media, toxic shock syndrome, and urinary tract infections are a few illnesses (Rasheed et al.,2020).
According to reports, 60% of diabetic foot ulcers (DFUs) were infected at the time of diagnosis, increasing the risk of a lower extremity amputation by 50% compared to DFUs without infection. Diabetic foot infection (DFI) is thought to be one of the most common and dangerous diabetes complications (Xie et al.,2017). Peripheral vascular disease, neuropathy, diabetes, shock, and low infection resistance are risk factors for DFUs, which continue to be the primary cause of lower limb amputations worldwide (Spichler et al., 2015). While chronic infections and infections that have already been treated are often polymicrobial, containing both aerobic and facultative anaerobic gram-negative bacteria, the majority of lesions in patients with acute infections are caused by aerobic gram-positive cocci (usually monomicrobial infections) (Charles et al., 2015).
According to Dursun et al., (2018), the presence of bacteria such as Klebsiella pneumoniae, Proteus spp.,E. coli, Enterococcus, Streptococcus,Acinetobacter baumannii, and Pseudomonas spp. ,Staphylococcus aureus, can cause wounds to become chronic.
Almost everyone will get an infection caused by Staphylococcus aureus at least once in their lifetime. Of all human diseases, nosocomial infections are caused by a major pathogenic bacteria that is acquired in the community. bacteria that affect all age groups and both sexes, causing varying infection effects (Suhaili et al., 2018). Staphylococcus aureus is resistant to methicillin When the mecA gene, which codes for Penicillin-binding protein 2, is acquired, beta-lactam drugs become resistant to them. Due to its low affinity for beta-lactam medications, penicillin-binding protein 2 causes beta-lactam resistance. The Major Facilitator Superfamily (MFS) of secondary transporters (TMS) includes the 388-amino acid protein NorA, which has 12 Tran membrane segments (Wijesundara et al., 2019). This study aims to detect of virulence Staphylococcus aureus by mecA in patients with diabetes.
Material and Methods
Samples collection
Between December 2021 and March 2022, 300 patient samples were taken from patients with diabetic foot ulcers who were confined to bed at Al-Kindy Teaching Hospital. The samples were then planted in container dishes on the mediums of blood agar and MacConkey agar in a planned manner, kept at 37 C, and inverted for a full day. After that, single colonies were transferred to the solid saline manito-manitou medium using the same planning method, where the colonies growing on the MAS medium displayed a golden hue. The isolates underwent the required phenotypic and biochemical testing to confirm that they are Staphylococcus aureus (Drinka and Christopher, 2012).
Bacteria identification and sensitivity antibiotics test
Tests and procedures were used in the identification of bacterial isolates used as study samples. The ability to ferment menthol sugar and its golden color were the primary phenotypic features used to detect bacterial isolates grown atop MAS medium in single cultures. It was detected using the Vitek 2 compact system and also, it was conducted sensitivity test by Vitek 2 compact
Genetic detection of gene
DNA of bacteria was extracted using Extraction Mini Kit /Intron/Korea (Cata:17045).Primers (Table 1) from company Alpha DNA/USA. PCR ( polymerase chain reaction ) was carrıed out amplıfy genes at a final volume of 25μl including 1.5 μl of DNA sample, 1 μl of forward and 1 μl of reverse primers , 5µl of Taq PCR premix(Intron/Korea) , and 16.5 μl of nuclease free water. The tubes were transferred to a thermocycler and the conditions are in Table (1). After that, the PCR product was electrophoresed in gel agarose by using a Red safe stain and visualized bands in UV transilluminator.
Table 1: Primers sequences

Primer sequence Genes Tm

(ᵒC)

GC% Product size

Reference

5’-TCCAGATTACAACTTCACCAGG-3’ mecA 64 69.45 162bp (Duarte and Hermínia, 2002)
5’-CCACTTCATATCTTGTAACG-3’ 56 64.15

Results
Isolation of bacteria from diabetic foot ulcer
The results showed that out of the 300 isolates, only 171 isolates were identified as staphylococcus spp. Figure 1 shows the bacterial species number that isolated from diabetic foot ulcer.

Figure 1: Bacterial species number in diabetic foot ulcer
The isolates grown on solid saline mannitol medium had a significant capacity for mannitol sugar fermentation and a pinkish to yellow color shift in the media. They also showed the ability to tolerate growth at a concentration of 7.5% as a primary component in this medium. The ability of the chosen isolates to proliferate and produce a favorable outcome in less than 12 hours (Figure 2). Also, it was identified as S. aureus by Vitek 2 compact with a probability 98%(Figure 3).

Figure2: Bacteria growth on MSA. Solid saline mannitol medium

Figure 3:S. aureus by Vitek 2 compact

 

 Figre4: Antibiotics sensitivity of S. aureus

 

Table2: Antibiotics sensitivity of S. aureus

Antibiotics Resistant Intermediate Sensitive
MIC MIC MIC
Cefoxitin 150(100) >=4
Benzylpencillin 150(100) >=0.5
Oxacillin 150(100) POS
Gentamicin 3(2) >=16 147(98) <=0.5
Tobramycin 150(100) <=1
Levofloxacin 150(100) <=0.12
Moxifloxacin 150(100) <=0.25
Erythromycin 3(2) 2 147(98) <=0.25
Clindamycin 24(16) 4 126(84) <=0.25
Linezolid 150(100) <=0.5
Teicoplanin >=32 12(8) 32 138(92) <=0.5
Vancomycin 15(10) >=32 135(90) <=0.5
Tetracycline 15(10) 2 135(90) <=1
Tigecycline 150(100) <=0.12
Ciprofloxacin 150(100) <=0.5
Nitrofurantin 3(2) 128 6(4) 64 141(94) <=16
Fusidic acid 39(26) 4 111(74) <=0.5
Rifampicin 9(6) 1 141(94) <=0.5
Trimethoprime – sulphamethoxazole 150(100) <=10

 

 Gene detection

The results showed the presence mecA in Staphylococcus aureus isolates in Figure 5.

Figure5:  The electrophoresis for mecA gene (162bp) on 1.5% agarose /1:30 hours .DNA ladder (100bp)

 

Sequencing analysis of mec A gene.

It detected the sequencing of genes (mecA,and norA). Sequencing the results showed 98% compatibility with the reference strain ID: CP092561.1 in Genbank and with one type substitution (transversion G/T) in site 40016 nucleotides of the mecA   gene. For the second sample, the matching percentage was 97% with ID: GP092561.1 and with 3 type transversion T to A at location 39911 and G/T at location 40016 and A/T at location 40024 and one gap numbere 40028 location in the gene bank. For the third sample, ID: CP092561.1, the compatibility was 95% with gene bank and it showed GAP in the nucleotide location 39921, and it showed two transition G/A at location 39923, T/C at location 39962 and 4 trans versions (G/T 39962, A/T 42991, G/T 40016 and A/T 40024, The results are shown in figures (6 – 8).

Score Expect Identities Gaps Strand
212 bits (234) 4e-56 120/122(98%) 0/122(0%) Plus/ Plus

Query  5      GATTTATCTTTTTGCCAACCTTTACCATCGATTTTATAACTTGTTTTATCGTCTAATGTT  64              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  39906  GATTTATCTTTTTGCCAACCTTTACCATCGATTTTATAACTTGTTTTATCGTCTAATGTT  39965

Query  65     TTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTGAACCTGGGGAAGTTGAA  124             |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |

Sbjct  39966  TTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTGAACCTGGTGAAGTTGTA  40025

Figure 6: The nucleotide sequence of the Staphylococcus aureus macA gene as alignment with sequence reference strain for Staphylococcus aureus. chromosome of Gen Bank (NCBI) under ID: CP092561.1

Score Expect Identities Gaps Strand
206 bits (228) 2e-54 122/126(97%) 1/126(0%) Plus/ Plus

Query  7      TTTTTCTTTTTGCCAACCTTTACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTT  66

||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  39908  TTTATCTTTTTGCCAACCTTTACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTT  39967

Query  67     GTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTGAACCTGGGGAAGTTGAAAT  126              |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||

Sbjct  39968  GTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTGAACCTGGTGAAGTTGTAAT  40027

Figure 7: The nucleotide sequence of the Staphylococcus aureus macA gene as alignment with sequence reference strain for Staphylococcus aureus. chromosome of Gen Bank (NCBI) under ID: CP092561.

Score Expect Identities Gaps Strand
171 bits (189) 1e-43 107/114 (95%) 1/114(0 %) Plus/ Plus

Query  8      CTTTTTGCAGCTTTTACCATCGATTTTATAACTTGTTTTATCGTCTAAGGTTTTGTTAT  66

              |||||||| | | |||||||||||||||||||||||||||||||||||| ||||||||||

Sbjct  39913  CTTTTTGCCAACCTTTACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTAT  39972

Query  67     TTAACCCAATCATTGCTGTAAATATTTTTTGAGTTGAACCTGGGGAAGTTGAAA  120

              ||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||

Sbjct  39973  TTAACCCAATCATTGCTGTTAATATTTTTTGAGTTGAACCTGGTGAAGTTGTAA  40026

Figure 8: The nucleotide sequence of the Staphylococcus aureus macA gene as alignment with sequence reference strain for Staphylococcus aureus. chromosome of Gen Bank (NCBI) under ID: CP092561.

 

 

Discussion

Globally, diabetic foot infections are a common, difficult, and costly ailment (Boulton, 2019). In this study, 150 diabetic patients with foot infections will have their microbiological profiles and virulence factors assessed. in particular about risk factors and microorganisms that are resistant to many drugs. A total of 300 specimens from patients with diabetic foot ulcers were obtained, of these, 274 (91%) showed positive results for bacterial growth during culturing, whereas 26 (9%) showed negative results. Anaerobic bacteria, fungi, viruses, and other causative agents of infection can also result in negative growth (Jain and Barman, 2017). Alternatively, the wounds may not have been infected at the time of the study, or the recommended antibiotics may not have been effective(Abdul Qadir et al.,, 2014).

As one of the most frequent causes of nosocomial infections, MRSA has spread throughout the world and is now a major public health concern, according to the current study’s results, which also revealed that 100% of MRSA exhibited the highest resistance to cefoxitin (Al-Dhabi, 2013). Every isolate that was discovered exhibited total resistance to cefoxitin and oxacillin, respectively. The results of this investigation showed increased resistance to β-lactam antibiotics, such as penicillin and cefoxitin (which function as a stand-in for methicillin). The two processes causing this resistance are the particular acquisition of staphylococcal SCCmec and the production of the β-lactamase enzyme, which hydrolyzes the β-lactam ring and renders the antibiotic ineffective.

which carries the gene mecA, which codes for a protein called penicillin-binding protein (PBP2a). This protein has a poor tendency (affinity) to attach to β-lactams by substituting the endogenous PBP enzyme, which is the antibiotic’s target. As a result, the synthesis of the cell wall remains active, and the growth of Staphylococcus aureus is also unaffected because of its resistance to β-lactam inhibition, which makes the bacteria resistant to a wide range of antibiotics, including penicillin and β-lactams (Da Costa et al., 2018,Lee et al.,2018).

Ninety percent of the clinical Staphylococcus aureus isolates in the current study carried the mecA gene . The mecA gene is amplified by polymerase chain reaction (PCR), which is why MRSA is known as the “gold standard.” )Jonas et al., 2002)According to earlier studies, the mecA gene was found in 94.33 percent of S. aureus isolates (Raheema, 2019) and 75.5 % (Kareem et al, 2015). Real-time/conventional PCR revealed that 41.6% of Staphylococcus aureus in Sulaymaniyah, Kurdistan Region, Iraq, possessed the mecA gene in the study conducted by )Anwar et al., 2020).

The norA gene is present in 97% of methicillin-resistant Staphylococcus aureus in our current investigation. This is in line with the research conducted by Al-Khazraji (2020), who discovered that the gene appears at a rate of 97.5%. Our findings also align with the research conducted by Noor (2019), whose samples were gathered from multiple sources and whose gene percentage was found to be roughly 100%.

Conclusions

According to our research, benzyl penicillin and oxyacillin were the most resistant to antibiotics, whereas trimethoprim-sulfamethoxazole and ciprofloxacin were the most susceptible.
3. The results show that the prevalence of methicillin-resistant Staphylococcus aureus has significance for both genotype and phenotype. Research has shown that the norA gene can be used to identify Staphylococcus bacteria. The study verified that using contemporary techniques for diagnostics, such PCR and Vitek2, is more dependable than using outdated, customary techniques.

 

Acknowledgment

None

Conflicts Interest

None

References

  • Abdul Qadir, D., Ali, S. A., and Mahmoud, H. M. (2014). Prevalence of bacterial types in Wagner grade three of diabetic foot ulcer. Iraqi Journal of Science, 55(3B), 1232- 1235.
  • Al-Dahbi, A. M., and Al-Mathkhury, H. J. (2013). Distribution of Methicillin Resistant Staphylococcus aureus in Iraqi patients and Healthcare Workers . Iraqi Journal of Science, 54(2), 293–300.
  • AlKhazraji, N. Z., Al Jubouri, A. S., and Al Ma, M. F. (2020). Detection of Antiseptic Resistant Genes and Biofilm Formation in Multidrug Resistant Staphylococcus aureus in Baghdad Hospitals. Iraqi journal of biotechnology, 19(2).
  • Altaee, F., M., Younis, W., R. and Kamona, K., Z. (2020). Activity of annona Squamosa peels extracts against two pathogenic bacteria and two blood cancer cell lines. iraqi journal of agricultural sciences, 51(6), 496-1503.
  • Anwar, K., Hussein, D., and Salih, J. (2020). Antimicrobial Susceptibility Testing and Phenotypic Detection of MRSA Isolated from Diabetic Foot Infection. International Journal of General Medicine, 13, 1349.‏
  • Boulton, A. J. (2019). The diabetic foot. Medicine, 47(2), 100-105.
  • Charles, P., Uçkay, I., Kressmann, B., Emonet, S., and Lipsky, B. (2015). The role of anaerobes in diabetic foot infections. Anaerobe, 34, 8-13.
  • Da Costa, T. M., De Oliveira, C. R., Chambers, H. F. and Chatterjee, S. S. (2018). PBP4: A new perspective on Staphylococcus aureus β-Lactam resistance. Microorganisms, 6(3), 57.
  • Drinka,P.,Bonham, P. and Christopher,J.(2012).Swab culture of puruleny skin infection to detect infection or colonization with anyibiotic-resistant bacteria.  ,Rwviews Microbiology,16(9),P.523.
  • Dursun, A., Özsoylu, S., Kılıç, H., Kılıç, A.U. and Akyıldız, B.NÇocuk., Yoğun Bakım Ünitesinde Yatan Hastalardan İzole Edilen ,.(2018). Pseudomonas aeruginosa, Klebsiella pneumoniae vs Acinetobacter baumannii suşlarının antibiyotik duyarlılıkları. Turkish Journal of Intensive Care, 16(3),109-114.
  • Jain, S.k. and Barman, R.(2017). Bacteriological Profile Of Diabetic Foot Ulcer With Special Reference To Drug-Resistant Strains In A Tertiary Care Center In North – East India. Indian J Endocr Metab, 21:44–50.
  • Jonas, D., M. Speck, F.D. Daschner and H. Grundmann (2002). Rapid PCRBased Identification of[ Methicillin-Resistant Staphylococcus aureus from Screening Swabs. J .Clin.Microbiol., 40: 1821-1823.
  • Kareem, S. M., Al-Jubori, S. S., and Ali, M. R. (2015). Prevalence of erm genes among methicillin resistant Staphylococcus aureus MRSA Iraqi isolates. Int J Curr Microbiol Appl Sci, 4(5), 575-585.).
  • Lee, A. S., de Lencastre, H., Garau, J., Kluytmans, J., Malhotra-Kumar, S., Peschel, A. and Harbarth, S. (2018). Methicillin-resistant Staphylococcus aureus. Nature reviews Disease primers, 4(1), 1-23.
  • Noor J. Abbas. )2019 (Bacteriological and Molecular Study of Staphylococcus aureus Isolated from Different Clinical Sources. a thesis submitted to the council of the college of education for pure Sciences/ Ibn Al-Haitham University of Baghdad.
  • Raheema, R.H. and K.A. Abed (2019). Molecular identification of Virulence Genes of Staphylococcus aureus Isolated from Different Clinical Isolates. Indian Journal of Public Health Research and Development, 10(2).
  • Rasheed, T., H., Luti, K., J., K. and Alaubydi, A., M. (2020). Purification and characterization of bacteriocin from Lactobacillus acidophilus ht1 and its application in a cream formula for the treatment of some skin pathoges. iraqi journal of agricultural sciences, 51(5), 1381-1393.
  • Spichler, A., Hurwitz, B., Armstrong, D., and Lipsky, B. (2015). Microbiology of diabetic foot infections: from Louis Pasteur to ‘crime scene investigation’. BMC Medicine, 13(1).
  • Suhaili, Z., Rafee, P. A., Mat Azis, N., Yeo, C. C., Nordin, S. A., Abdul Rahim, A. R., Mohd Desa, M. N. (2018). Characterization of resistance to selected antibiotics and panton-valentine leukocidin-positive Staphylococcus aureus in a healthy student population at a Malaysian university. Germs, 8(1):21–30. Surveillance: World Health Organization.
  • Wijesundara, W., Rajapakse, R., Jayatilake, J., and Jayatilake, J. (2019). A preliminary study of mecA gene expression and methicillin resistance in staphylococci isolated from the human oral cavity. Sri Lankan Journal of Infectious Diseases, 9(1).
  • Xie, X., Bao, Y., Ni, L., Liu, D., Niu, S., and Lin, H. et al. (2017). Bacterial Profile and Antibiotic Resistance in Patients with Diabetic Foot Ulcer in Guangzhou, Southern China: Focus on the Differences among Different Wagner’s Grades, IDSA/IWGDF Grades, and Ulcer Types. International Journal of Endocrinology, 2017, 1-12.

You might also enjoy

More articles